het siRNAsPlant small RNA genesmiRNA

SITE UNDER CONSTRUCTION - BE WARNED, NOT FULLY FUNCTIONAL OR TESTED

Amborella trichopoda genome build 1

Amborella

These are small RNA annotations from the basal angiosperm Amborella trichopoda. The small RNA data and earlier annotations derive from the 2013 paper in Science. The newer atr-b1r2 annotations derive from a re-analysis of the small RNA-seq data with up-to-date methods.


Genome and small RNA-seq summary page

Genome Browser

Browse to a specified location (example: 'AmTr_v1.0_scaffold00001:2665304..2668417')


Searches

Search for an annotation (examples: 'atr-MIR390', 'atr-b1r2-2148')

Search for a small RNA (example: 'AAGCUCAGGAGGGAUAGCGCC')


Retrieve annotation data

Current automated small RNA annotations: atr-b1r2. Total = 46,620 Download csv file

MIRNA annotations from miRBase21: atr-MIR. Total = 124 Download csv file

Legacy small RNA annotations from Amborella genome consortium, 2013: ShortStack_AmTr_v1. Total = 56,209 Download csv file