het siRNAsPlant small RNA genesmiRNA

SITE UNDER CONSTRUCTION - BE WARNED, NOT FULLY FUNCTIONAL OR TESTED

Physcomitrella patens genome build 3.0

These are small RNA gene annotations of the version 3.0 genome assembly from Phytozome 10. There are several different annotations available, many of which derived from our earlier papers (see below).


Genome and small RNA-seq summary page

Genome Browser

Browse to a specified location (example: 'Chr21:9337958..9338265')


Searches

Search for an annotation (examples: 'ppt-MIR390a', 'ppt-b3.0r4-2208', 'PpTAS3a')

Search for a small RNA (example: 'AAGCUCAGGAGGGAUAGCGCC')


Retrieve annotation data

These annotation data were quantified based on the small RNA-seq alignments of reference set 4. The different annotations came from different studies, and many of them overlap. Some of the older annotations may have no aligned reads; this reflects changes (improvements!) in our methodology since those older studies. The best annotations are those in the current set (ppt-b3.0r4) and the miRBase hairpins.

Current automated small RNA annotations: ppt-b3.0r4. Total = 10,784 Download csv file

MIRNA annotations from miRBase21: ppt-MIR. Total = 227 Download csv file

TAS (trans-acting siRNA) loci annotations from Arif et al., 2012: Ppv3. Total = 9 Download csv file

Older small RNA annotations from Coruh et al., 2015: Ppv3. Total = 1,446 Download csv file

Older small RNA annotations from Cho et al., 2008: Pp21SR and Pp23SR. Note that the locations of these loci were re-mapped from their original version 1 genome locations onto the version 3.0 assembly. In some cases, loci are split or re-arranged due to assembly differences. Total = 143 Download csv file